DPMIND

Species > Oryza_sativa > osa-miR444d.1

Mature miRNA osa-miR444d.1:

> osa-miR444d.1|108..128
UUGCUGCCUCAAGCUUGCUGC

Pre-miRNA osa-miR444d:

> osa-miR444d|Chromosome position not available
AGUUAUUGCACAUGGUGGCACCAAGCAUGAGGCAACAACUGCAUUACUUGCAAGAAAGGCACAAAAUCAUUAGAU
GAUUACUUGUGGCUUUCUUGCAAGUUGUGCAGUUGCUGCCUCAAGCUUGCUGCCUCCCUCUGCCAAAU

More information:

miRBase

Verified Target Gene:

View the interactions between osa-miR444d.1 and its Targets

Experimental Evidences:

MPSS [1], Northern [1]

References:

[1] "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"; Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
[2] "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)"; Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ; Proc Natl Acad Sci U S A. 105:4951-4956(2008).
[3] "Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa"; Morin RD, Aksay G, Dolgosheina E, Ebhardt HA, Magrini V, Mardis ER, Sahinalp SC, Unrau PJ; Genome Res. 18:571-584(2008).