DPMIND

Species > Oryza_sativa > osa-miR444a-3p.1

Mature miRNA osa-miR444a-3p.1:

> osa-miR444a-3p.1|99..119
UUGCUGCCUCAAGCUUGCUGC

Pre-miRNA osa-miR444a:

> osa-miR444a|Chromosome position not available
AUGCAAUUGGGGGCAGCAAGCUAGAGGUGGCAACUGCAUAAUUUGCAAGAAAUUGUUGGCUGAAGAUCAUACCGA
UGAUAUUCUUGCAAGUUAUGCAGUUGCUGCCUCAAGCUUGCUGCCUCCUGUUGCCA

More information:

miRBase

Verified Target Gene:

View the interactions between osa-miR444a-3p.1 and its Targets

Experimental Evidences:

cloned [1], MPSS [2], Northern [2]

References:

[1] "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"; Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
[2] "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)"; Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ; Proc Natl Acad Sci U S A. 105:4951-4956(2008).
[3] "Differential expression of the microRNAs in superior and inferior spikelets in rice (Oryza sativa)"; Peng T, Lv Q, Zhang J, Li J, Du Y, Zhao Q; J Exp Bot. 62:4943-4954(2011).