DPMIND

Species > Oryza_sativa > osa-miR3979-5p

Mature miRNA osa-miR3979-5p:

> osa-miR3979-5p|13..32
UCUCUCUCUCCCUUGAAGGC

Pre-miRNA osa-miR3979:

> osa-miR3979|Chr 11: 19480150..19480263
GGUUUUCUUGGAUCUCUCUCUCCCUUGAAGGCUAUCUCAUGGAGGUUUGAUGUACACCAUUGUUGCCUAAGAAAC
UGAGAAAGCCUUCGGGGGAGGAGAGAAGCCAAGCAAGCC

More information:

miRBase

Verified Target Gene:

View the interactions between osa-miR3979-5p and its Targets

Experimental Evidences:

Illumina [1]

References:

[1] "Identification and analysis of seven H(2)O(2)-responsive miRNAs and 32 new miRNAs in the seedlings of rice (Oryza sativa L. ssp. indica)"; Li T, Li H, Zhang YX, Liu JY; Nucleic Acids Res. 39:2821-2833(2011).
[2] "Differential expression of the microRNAs in superior and inferior spikelets in rice (Oryza sativa)"; Peng T, Lv Q, Zhang J, Li J, Du Y, Zhao Q; J Exp Bot. 62:4943-4954(2011).
[3] "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage"; Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ; Plant Cell. 23:4185-4207(2011).