DPMIND

Species > Medicago_truncatula > mtr-miR2119

Mature miRNA mtr-miR2119:

> mtr-miR2119|94..114
UCAAAGGGAGGUGUGGAGUAG

Pre-miRNA mtr-miR2119:

> mtr-miR2119|Chr 5: 18765366..18765495
UUUAUUUUUUUUACACUAAGAUACUCCCUACUUUCCUUUGAUUGGAAAUAAAGAGAGACAAAAAGGUAAAUUUAA
UUUCUCUUCUUAUGUCAAUCAAAGGGAGGUGUGGAGUAGAGGUGUAAAAAGUAAA

More information:

miRBase

Verified Target Gene:

View the interactions between mtr-miR2119 and its Targets

Experimental Evidences:

454 [2-3], Northern [2]

References:

[1] "Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress"; Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL; Plant Mol Biol. 70:385-401(2009).
[2] "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families"; Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R; New Phytol. 184:85-98(2009).
[3] "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules"; Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M; Plant Cell. 21:2780-2796(2009).