DPMIND

Species > Arabidopsis_thaliana > ath-miR472-5p

Mature miRNA ath-miR472-5p:

> ath-miR472-5p|14..34
AUGGUCGAAGUAGGCAAAAUC

Pre-miRNA ath-miR472:

> ath-miR472|Chr 1: 4182132..4182299
UCUGUAUGUAUGUAUGGUCGAAGUAGGCAAAAUCUCACCUUUCUAGCAGAUCAACAAUGAAUUUUGUGGAAUAGA
UGUUGGAUUUGUAAGGUUUUGGUGUUUGCAAGUGUUGAGAUGCGCAAGAUUUGAGUAAGAUUUUUCCUACUCCGC
CCAUACCAUACAUACACC

More information:

miRBase

Verified Target Gene:

View the interactions between ath-miR472-5p and its Targets

Experimental Evidences:

Illumina [4]

References:

[1] "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependentRNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS,Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006).
[2] "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"; Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC; PLoS One. 2:e219(2007).
[3] "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006).
[4] "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"; Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA; BMC Genomics. 14:701(2013).