DPMIND

Species > Arabidopsis_thaliana > ath-miR408-3p

Mature miRNA ath-miR408-3p:

> ath-miR408-3p|120..140
AUGCACUGCCUCUUCCCUGGC

Pre-miRNA ath-miR408:

> ath-miR408|Chr 2: 19319814..19320031
AAGGUUAGAUUGGUAUUGCAAUGAAAGAAGACAAAGCGGUAAUGAGAGAGAGACAGGGAACAAGCAGAGCAUGGA
UUGAGUUUACUAAAACAUUAAACGACUCUGUUUUGUCUCUACCCAUGCACUGCCUCUUCCCUGGCUCCCUCUUUU
UUUCUCUAUAUUUCUCUCUCUCCUUUCAUUUCACAGCUUUCAAUGGAAUUUUAUUGCUACUGCUAACG

More information:

miRBase

Verified Target Gene:

View the interactions between ath-miR408-3p and its Targets

Experimental Evidences:

cloned [1], Northern [1], 454 [2-3], MPSS [2], Illumina [4]

References:

[1] "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"; Sunkar R, Zhu JK; Plant Cell. 16:2001-2019(2004).
[2] "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependentRNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS,Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006).
[3] "A diverse and evolutionarily fluid set of microRNAs in Arabidopsisthaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006).
[4] "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs inArabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010).
[5] "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"; Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA; BMC Genomics. 14:701(2013).