DPMIND

Species > Arabidopsis_thaliana > ath-miR398c-5p

Mature miRNA ath-miR398c-5p:

> ath-miR398c-5p|12..32
AGGGUUGAUAUGAGAACACAC

Pre-miRNA ath-miR398c:

> ath-miR398c|Chr 5: 4694694..4694808
UGGAUCUCGACAGGGUUGAUAUGAGAACACACGAGCAAUCAACGGCUAUAACGACGCUACGUCAUUGUUACAGCU
CUCGUUUCAUGUGUUCUCAGGUCACCCCUGCUGAGCUCUU

More information:

miRBase

Verified Target Gene:

View the interactions between ath-miR398c-5p and its Targets

Experimental Evidences:

References:

[1] "Computational identification of plant microRNAs and their targets,including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004).
[2] "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"; Sunkar R, Zhu JK; Plant Cell. 16:2001-2019(2004).
[3] "Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005).
[4] "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependentRNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS,Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006).
[5] "A diverse and evolutionarily fluid set of microRNAs in Arabidopsisthaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006).