DPMIND

Species > Arabidopsis_thaliana > ath-miR393b-3p

Mature miRNA ath-miR393b-3p:

> ath-miR393b-3p|132..152
AUCAUGCGAUCUCUUUGGAUU

Pre-miRNA ath-miR393b:

> ath-miR393b|Chr 3: 20691647..20691806
AGAGAAAGGAUCCAAAGGGAUCGCAUUGAUCCUAAUUAAGCUGAUUUAUUCCCCAAUAAUUGUUUUUUUUUUCCU
UCUCAAUCGAAAGAUGGAAGAAAAACAAAUUCCAAACAUUUUGCUUACUUUUCCGGAUCAUGCGAUCUCUUUGGA
UUCAUUCUUU

More information:

miRBase

Verified Target Gene:

View the interactions between ath-miR393b-3p and its Targets

Experimental Evidences:

Illumina [5]

References:

[1] "Computational identification of plant microRNAs and their targets,including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004).
[2] "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"; Sunkar R, Zhu JK; Plant Cell. 16:2001-2019(2004).
[3] "A diverse and evolutionarily fluid set of microRNAs in Arabidopsisthaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006).
[4] "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependentRNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS,Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006).
[5] "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"; Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA; BMC Genomics. 14:701(2013).